Автор неизвестен - Krmulture in iran - страница 43

Страницы:
1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53 

Tuernau D, Schmidt H, Kuerzinger H, Boehm KH, 2000 Potency testing of beta-glucan immunostimulating effect in food for ornamental fish, Bullten of European association of fish pathol 20:143-147

Wache Y, Auffray F, Gatesoupe FJ, Zambonino J, Gayet V, Labbe L, Quentel C. 2006. Cross effects of the strain of dietary Saccharomyces cerevisiae and rearing conditions on the onset of intestinal microbiota and digestive enzymes in rainbow trout, Onchorhynchus mykiss, fry. Aquaculture 258: 470-478.

Nutritional effect of Saccharomyces cerevisiae extract on growth enhancement with adding on diet during first month feeding of Cyprinus carpio

Javad Sahandi1, Hojatollah Jafaryan1, Christina Tadiri2

1 Department of fishery, faculty of natural resource, University of Gonbad Kavous,

Golestan, Iran

2 Department of biology, McGill University, Montreal, Canada * Corresponding author: sahandijavad@gmail.com

Abstract

The present study was carried out to evaluate the influence of Saccharomyces cerevisiae extract effect (A-Max) on growth and survival of Cyprinus carpio. This trail was lasted for 4 weeks and during this study 270 carp larvae with 400 mg initial body weight were obtained from Shahid Chamran hatchery (Golestan- Iran). They were divided in 4 treatments with three replicates. Larvae were fed with diet that supplemented with 2.5, 4 and 5.5 mg of yeast extract per 100 g feed respectively. Growth parameters and fish survivalwere assessed after 4 weeks and obtained results showed the significant effect on growth of T1 (2.5 mg) and T2 (4 mg) than T3 (5.5 mg) and control (P<0.05). Diet supplementing with yeast extract at the effective weight due to increasing of growth rate during cultivation period.

Introduction

Cyprinus carpio is a strategic species that originated to central Asia. This species was cultured in all over the world since it's dominated easily. With this invasive promotion, improvement of production would be happened and the important factor is nutrition. Common carp is anomnivore's species which achieve its feed from nature. Now a day's researcher study about improvement of fish growth and survival rate. Up

to now they offer some methods for this goal and probiotic are one of them. Probiotics can be defined as live microbial feed supplement whichbeneficially affects the host animal by improving its intestinal balance (Fuller 1992).Effectivecolonization in digestive tract of larvae involves competition with theestablished micro flora for attachment sites and nutrients. Though probiotic are widely used for this trail to induce useful bacteria into fish digestive system. The main strategy in use today is supplementation of the probiotics bacteria into feed of immature fishes, for increase the growth parameters (Ghosh et al., 2003). In this study supplementation process used for addition of main concentrations of Saccharomyces cerevisiae extract (A-Max) into the larvae feed. The appropriate use of probiotics in the aquaculture industry were shown to improve intestinal microbial balance, and also to improve feed absorption, thus leading to increased growth rate (Fuller 1989; Gibson and Roberfroid, 1995) and also increased immune system during the cultural period (Ringo and Birkbeck, 1999).

Material and methods

Six hundred and sixty common carp larvae with anaverage body weight of 478.74 ± 216.08 mg wereprocured from Shahid Chamran carp farm (Golestan, Iran). Initially, allfish were stocked in a tank withoutfeeding for 48 hrs. Then prior to theexperiment, fish were randomly divided into 12 tankswith 10 liters capacity with 3 fish per liter.Based on observations and feeding behaviorof common carp larvae during the trial,they were feed up to satiation 3 times a day.Fish were weighed once every week. Theduration of the experiment was 4weeks.The trials were conducted on a12L:12D photoperiod. Water parameterslike temperature and pHwere 27°Cand 7.8 respectively.

After trail duration fish were challenged with acidic PH (PH = 2), Basic PH (PH = 12), Thermal stress (40°C) and Ammonia (5ml/L) according to Jafaryan et al., (2009) to test fish resistance of the experimental groups of fish by toleration time in minute. Environmental stress in fish farms resulting in rapid mass mortality which is

economically disastrous to the fish producer. The experiment was carried out in 48 distinct experimental groups. Each experiment was done with five fishes of each replicates of experimental treatment. After fish stocking into prepared tanks of challenges immediately toleration time was recorded in minute. In all the cases, feeding was performed up to satiation three times daily. Statistical analysis of data was performed by analysis of variance (ANOVA) using SPSS-19 followed by Duncan's multiple range tests (P<0.05).

During study, results showed no significant difference as it performed in figure 1. But significant growth performance was observed between treatmentsafter last analyzes.

Figure l.Weight growth performance during 4 weeks of study

Results

1600

1400

Control

1st week 2nd week 3rd week 4th week 5th week

Feeding duration

The same results were observed about length growth rate which is presented in figure 2.

Figure 2. Length growth performance during 4 weeks of study

?

t

o r

t

g n

e 1600 1400 1200 1000

800

600 400 200 0

1st week 2nd week 3rd week 4th week 5th week Feeding duration

■ Control

■ T3

Similarly weight growth performance, length growth performance showed difference between treatments during first three weeks of trail but it's not statistically significant (P>0.05). The last analyzes showed significant difference between groups. T1 and T2 showed the highest growth rate in weight and length growth and likewise T3. Significant difference were observed between experimental treatments and the control in growth (P<0.05). There are significant differences in other growth parameters which are presented in table 1.

Table 1. Growth parameters of Cyprinus carpio performance

^^^-^^ Treatment

Control

T1

T2

T3

Parameter

 

 

 

 

Weight gain (g)

0.70± 0.42b

0.87± 0.51a

0.87± 0.56a

0.79± 0.47ab

Food Conversion Ratio

1.63 ± 0.58a

1.45 ± 0.56b

1.47 ± 0.56b

1.52 ± 0.52ab

Specific Growth Rate

2.89 ± 1.19b

3.22 ± 1.26a

3.20 ± 1.31a

3.05 ± 1.19ab

Protein Efficiency Ratio

1.63 ± 0.59b

1.87 ± 0.71a

1.87 ± 0.77a

1.76 ± 0.65ab

Lipid Efficiency Ratio

5.04 ± 1.99b

6.27 ± 2.39a

6.28 ± 2.61a

5.92 ± 2.18ab

Condition Factor

1.75 ± 0.35a

1.64 ± 0.20b

1.64 ± 0.19b

1.77 ± 0.30a

The different letters in the same rows showed significant difference (P<0.05)

The survival time and infectivity of Saccharomyces cerevisiae and control feed fed Cyprinus carpio, when challenged with environmental stress (Jafaryan et al., 2009) are given in Table 2.

The survival time in yeast extract feed fed groups was more than that of the control feed fed groups but thermal challenge test was in contrast with other challenge results.

Table 2. Fish resistance time during challenges (minute)

 

Control

T1

T2

T3

 

0%

2.5%

4%

5.5%

PH 2

11.13 ± 2.37c

15.18 ±1.76a

12.97 ± 0.07b

12.97 ± 0.25b

PH 12

12.07 ± 1.36c

17.24 ± 1.69a

15.16 ± 2.18b

16.57 ± 1.50a

Ammonia (5ml/L)

2.11 ± 0.00c

2.44 ± 0.12b

2.93 ± 0.42a

3.00 ± 0.44a

Thermal (40°C)

0.62 ± 0.12a

0.52 ± 0.41ab

0.03 ± 0.01c

0.31 ± 0.43b

T1 which was fed with 2.5% yeast extract showed the highest resistance in PH 2 and after that T3 and T2 showed significant difference than control (P<0.05). The highest resistance in basic PH, (PH 12) was observed in T1 and T3. However T2 and T3 showed significant difference in ammonia challenge test than the control and T1.

Discussion

Presented results ensure the effect of yeast extract (A-Max) on growth and survival of common carp larvae during first month of feeding.Saccharomyces cerevisiae known as microbial organism that effect on fish growth, survival and resistance and it has been ensuring by Verschuere et al., (2000). The use of yeast extract improved carp growth rate and increased their resistance toward challenges. The same result was reported by Jafaryan et al., (2007) about rainbow trout with using of baker yeast with Bacillus species. The use of effective concentration is the important things that cause success of trail. In present study three concentrations were used (2.5%, 4% and 5.5%). Tover et al., (2002) reported that Saccharomyces cerevisiae has effect on promotion of digestive system and improved its operation. The same result was reported by Wache et al., (2006) in increasing of rainbow trout larvae digestion operation. T1 and T2 with high growth rate than the control was similar with Wache et al. (2006). The used probiotic increased common carp larvae resistance during challenge test and this result was

similar with Craken and Gaskins, (1999) and Lashkarbolouki et al.,

(2012).

References

Lashkarbolouki, M., Jafaryan, H., KeramatAmirkolaie, A., Farhangi, M., Adineh, H. (2012).The Effect of Yeast-Enriched (Saccharomyces cerevisiae) Daphnia magna on Growth and Stress Resistance in Persian Sturgeon (Acipenser persicus) Larvae, Journal of Fisheries, Iranian J.Natura. Resour, 64(4):345-355.

Craken, V.J., Gaskins, H.R., 1999. Probiotics and the immune system. In: Tannock, G.W. (Ed.), Probiotics: A Critical Review. Horizon Scientific Press, Wymondham, UK, pp. 85-112.

Wach6, Y., Auffray, F., Gatesoupe, F.J., Zambonino, J., Gayet, V., Labb6, L., Quentel, C., 2006. Cross effects of the strain of dietary Saccharomyces cerevisiae and rearing conditions on the onset of intestinal microbiota and digestive enzymes in rainbow trout (Oncorhynchus mykiss) fry. Aquaculture 258: 470—478

ovar,D., Zombonino-Infante, J.L., Cahu, C., Gatesoupe, F.J., Vazquez, R., Lesel, R., 2002. Effect of live yeast incorporation in compound diet digestion enzymes activity in sea bass larvae. Aquaculture 204: 113-123.

Verschuere, L., Rombaut, G., Sorgeloos, P. Verstraete, W., 2000. Probiotic bacteria as Biological Control Agents in Aquaculture.Micro.Mol. Biol. Rev. 64: 655-671.

Jafaryan, H., Chamanara, V., Papii, Sh., Khojamlii, S., 2007. The effects of Saccharomyces cerevisiae,B.licheniformis and B.laterosporus on the growth parameters in Rainbow Trout (Oncorhynchus mykiss)larvae International training course and workshop.Islamic Azad university of Ghaemshahr. 5 september2007. Ghaemshahr-Iran. P: 38.

Jafaryan, H., Taati, M., Slamloo, Kh., 2009. The effects of B. licheniformis and B. subtilisfor promoting resistance of Trichogaster tericoterus larvae in challenge with stress.Asian Pacific Aquaculture.2009 and Malaysian International Seafoods Exposition 2009 November3-6. Kuala Lumpur, Malaysia. PP: 250.

Fuller, R. (1992) Probiotics. The Scientific Basis.Chapman & Hall, London, UK, 398 pp.

Ghosh, K., Sen, S.K. & Ray, A.K. (2003) Supplementation of an isolated fish gut bacterium, Bacillus circulans, in formulated diets for rohu, Labeorohita, fingerlings. Israeli J. Aquacult., 55:13-21.

Fuller, R., 1989. Probiotics in man and animals. J. Appl.Bacteriol. 66, 365-378.

Gibson, G.R., Roberfroid, M.B., 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nut. 125: 1401-1412.

Ringo, E., Birkbeck, T.H., 1999. Intestinal microflora of fish larvae and fry. Aquac.

Res. 30: 73-93.

Investigation the lethal concentration (LC96) of ammonia compounds on beluga sturgeon Larvae Huso huso and effects of Nano Zeolite to removal of ammonia compounds from water

M. Salamroodi*1.

1 Fisheries Department, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Guilan, Iran.

Introduction:

Ammonia is the original nitrogenous pond products of fishes that emanated from decomposition of unused diets and fish excrements in water environments (Frances et al. 2000). Ammonia appears to have a direct effect on the growth of aquatic animals (Colt 2006) and cause decreased growth, disease resistance (Lemarie' et al. 2004) or even killed the culturing fishes (Wang et al. 2000). All fishes are sensitive to minor fluctuations of ammonia compounds. Two type of ammonia were observed in water resources - unionized ammonia (NH3) and ionized ammonium (NH4+) (Thurston et al. 1984). The toxicity of ammonia to fishes has been attributed mainly to the un-ionized form (NH3) while the ionized form (NH4+) is considered less toxic (Wood 2001). Relative proportion of each type depends on predominately to pH (Huang et al. 2010) and temperature, and to a lesser extent, salinity (Bower and Bidwell 1978). While pH increased, especially after 8, quantity of UIA increases dramatically more than ammonium ion; it is 300-400 times more toxic than NH4+ (Haywood 1983). Also when water temperature added, these were a decreasing proportion of unionized ammonia-N (UIA-N). Total both type of ionized ammonium and unionized ammonia so called TAN (Total Ammonia Nitrogenous) (swann 1993). Zeolites are one of the most effective materials that able to absorb the ammonia compounds. Zeolites absorbed the ammonium with ion exchanging property (Boranic 2001). They are further characterized by ability to los and gain water reversibly and to exchange some of their constituent

elements like Na+ and K+ with ammonium ion without major change of structure (Mumpto and Fishman 1977).

One of the best zeolites in ammonia removal is clinoptilolite (Bergero et al. 1994). Clinoptilolite has been found very effective in removing ammonia from water by means of its excellent ion exchange capacity since the seventies of last century (Wang et al. 2005). The adsorption characteristics of any zeolite are dependent upon the detailed chemical-structural makeup of the adsorbent. The Si/Al ratio and the cation type, number and location are particularly influential in adsorption (Akley 2003). These minerals have been widely used as cation exchange media for use in water softening and other applications (Mumpto and Fishman 1977). Recently, it has been used in detergents, aquaculture ponds and nuclear treatment, but it also has large potentials for other applications in liquid waste treatment (James et al. 2000). UIA in high levels showed different effects on variety of fishes. But Until today, no studies respecting ammonia compounds toxicity have been achieved for beluga sturgeon. This research tried to determine lethal concentration (LC96) of ammonia compounds on beluga sturgeon and survey the effects of Nano clinoptilolite zeolite to removal of ammonia compounds from water environment.

Materials and methods:

The trial performed in Ramsar culturing center, Iran. Temperature in all stages maintained to 28°C and pH were equivalent 8.6.Used ammonia was ammonium chloride (made by Merck Company; Germany). Total ammonia concentrations were measuring with hack colorimeter DR/890 (made by USA). All testing procedures were conducted to static water method.

This experiment consists of two stages preliminary and main test: In first, the experiment was conducted to determine the lethal concentration of total ammonia at 96 h in Beluga sturgeons Larvae and also from different amounts 0, 15, 20, 25, 30 mg/lit of ammonia salt were used with five treatments in triplicate, also In each basin 6 fishes with

average weight 1.3±0.1 g and total length 1.8±0.02 cm were placed. Treatments every 12 h were attended from behavior and mortality. After determine the lethal concentration of ammonia (LC96) in Beluga Larvae, the main test to measure the efficiency of Nano zeolite was assessed in removal of ammonia lethal concentration. The used zeolite was clinoptilolite type with 90 % purity (Table 1). They were supplied by Nano processing in different stages.

Table. 1. Zeolite components by clinoptilolite type

Component

%

SiO2

65.52

Al2O3

9.89

Na2O

2.31

K2O

0.88

MgO

0.61

CaO

3.17

Fe2O3

1.04

MnO

0.06

TiO2

0.21

H2O

7.25

Loss of ignition

10.02

In this stage, 120 Larvae's in 12 basins (with 35 liters capacity) were used and in each basin 10 fishes with the same weight and total length in first stage were placed. Initially the amount of substantial ammonia in the water was measured and then each basin equivalent to 25 mg/lit ammonia salt was added according to preliminary test. For preparation of Nano Zeolites, they were placed in 10 % sodium chloride solution at a temperature of 90 °C for 30 minutes and then washed with distilled water and the temperature 60 °C were dried for 1 hour. Comminute zeolite at 3 treatments in 5, 10, 15 g/lit with three replications for each treatment and a control treatment was used. Until the end testing, once every 12 hours the amount of ammonia in the water basin was measured. All behavioral

activity of fishes was recorded during this process.

The results of the correlation between treatments with each other by the Duncan test were evaluated.

Results

Based on the results in preliminary stage, highest mortality rate in doses of 25 and 30 mg/lit were observed. Ionized ammonia lethal concentrations were equivalent to 25 mg/lit in sturgeon Larvae's at 96 hours. High mortality rates were observed in the early hours. Treatments showed different mortality comparing together (Fig. 1). In first treatment as control treatment no mortality was observed. Ammonia measured in each treatment at the end of the preliminary stage that was equivalent to the initial amount. First behavioral symptoms such as gasping, swallowing water, the curvature of muscles, hit the basin sides, lack of balance and severe reaction to external factors were observed in fishes and over time, sat on the floor of the basins while resting back and eventually died. Nano zeolite used in the main test effectively reduced ammonia in the water. Most absorption of ammonia in the first 12 hours after the start of testing was recorded. Eventually, the absorption rate of ammonia by zeolite treatments with increasing Nano zeolites considerably increased. High levels of ammonia absorbed in the third treatment with 15 g/lit Nano zeolite were observed. Results indicate significant differences between treatments with each other and also control (p<0.05). The third treatment showed highest rate of absorption of ammonia than other treatments. With increasing Nano zeolite in each treatment, the survival rate of Larvae's also increased significantly (p<0.05). Fish survival rates were 100, 87 and 57 % in the main test treatments, respectively. Figure 2 indicate ionized ammonium decreased after 96 h in treatments. Ammonium levels in the first treatment after 12 hours from 25 mg/lit to 17 mg/lit reduced; after 48 hours, process of absorption ammonium greatly reduced. Second treatment after 12 hours, ammonium from 25 mg/lit to 13 mg/lit decreased and after 72 hours, absorption of ammonium ion greatly reduced. In third treatments

Ammonia levels after 12 h, from 25 mg/lit to 7 mg/lit decreased and after 96 hours, the amount of ionized ammonia was 3 mg (fig. 2).

Figure 3 showed the reduce amount of un-ionized ammonia during 96 hours in the treatments. After adding ammonium chloride to basins, ammonia was measured (fig. 3). Un-ionized ammonia in the first sampling is equivalent to 5.50 mg/lit in all treatments. In the first treatment; ammonia after 96 hours equal 3.76 mg/lit; in the second treatment, 2.88 mg/lit and in the third treatment, ammonia after 12 hours 1.55 mg/lit and after 96 hours the lowest rate among the treatments was equal to 0.52 mg/lit. Results indicate that this ability to absorbing ammonia by the Nano zeolite after some time depending on the amount of Nano zeolite that used for removal ammonia compounds and with decreasing ammonia, the Nano zeolites reached to saturation point and not being able to continue the absorbing of this compounds. Just like in main test (fig. 3) that in treatment 1 and 2 after about 48 h reached to saturation point but treatment 3 until the end of test absorbed the ammonia compounds.

Fig. 1. Larval mortality in different dosage of ammonia

12 3 4

Treatments

Fig. 4. Survival rate of the fishes in main test in different treatments Discussion

In this study the lethal concentration of ammonia was equal to 5.50 mg/l (25 mg/l NH4+). The lethal concentration in varieties of fishes is different and depends to species, age and environmental factors in water. In same experiments the 48h-LC5o was 59.4 mg/l of N-NH4 (0.34 mg/l of N-NH3) for smolts salmon (Knoph 1996). The lethal concentration for rainbow trout at 24h-LC5o was 0.05 - 0.08 mg/l of N-NH3 (Svoboda and Vykusova 1995). Also, the MATC (maximum acceptable toxicant concentration) for shrimp is below 5 mg/l of N-NH4 or 0.35 mg/l of N-NH3. Moreover, in laboratorial conditions the concentrations of NH3-N without any fishes were reduced from 27 to 3 mg/l at a retention time of 38 min (Miladinovica and weatherleyb 2008). The survival rate in beluga Larvae's by adding the amount of Nano zeolites were increased (fig. 4). Applying of Nano zeolites was directly relative to removal of ammonia compounds in this study. In the main test Nano zeolites during 96 h in treatment 3, the lethal concentration of unionized ammonia reached from 5.50 to 0. 52 mg/l while about 73 % of UIA in first 12 h were removed. However during the trial fishes showed many severe reactions like disquiet and spasm.

Actually, ammonia acts as a toxin and a stressor (FriasEspericueta

1999). The toxicity of ammonia is generally assumed to be due to the concentration of the unionized ammonia molecule (NH3) because of its ability to move across cell membranes (Colt 2006). In alkaline waters the amount of H+ available to react with NH3 and produce NH4+ is low, and in this condition the NH3 plasma-water gradient is reduced, decreasing NH3 excretion and consequently accumulating in the plasma and tissues (Wilkie and Wood 1996). Most biological membranes are permeable to ammonia but relatively impermeable to ammonium ions (Randall and Tsui 2002).The specific biochemical mechanism of ammonia toxicity in fish is not fully explained, but it has been shown that ammonia intoxication impairs ATP production, induces a store depletion of polysaccharide and plasma ions, alters the neuronal synaptic transmission, induces leucopenia, inflammation and degeneration of gills and kidneys (Lemarie et al. 2004). An ammonia molecule is too small to act as an antigen and cannot directly modify the immune system by acting in the usual way. In fact, carbohydrates stored in liver and muscles are the first nutrients used in response to stress conditions (Vijayavel et al 2006). Ammonia appears to have a direct effect on the growth of aquatic animals and can have a serious effect on the incidence of disease, especially under less optimum conditions of temperature and dissolved oxygen (Colt 2006). It was found that some teleost fish can employ ureogenesis when environmental conditions are not in favor of ammonia excretion, e.g. high alkalinity water, limited water sources or high environmental ammonia (Randall et al. 1989; Iwata and Deguchi 1995; Walsh 1997). Relevant to using of Nano zeolites in the main test (fig. 2 and 3), removed faster the ammonia compounds by more adding the Nano zeolites in different treatments. As well, after the specific time Nano zeolites reach to saturation point. Therefore, we should use a particular amount of Nano zeolites due to prevent ammonia compounds. Hence, it seems that Nano zeolites based on the main test able to remove effectively the ammonia compounds but this absorption rate relative to quantity of Nano zeolites will distinctive.

Ackley MW, Rege SU, Saxena H. 2003. Application of natural zeolites in the purification and separation of gases. Microporous and Mesoporous Materials 61: 25-42.

Bergero D, Boccignone M, Palmegiano GB. 1994. Ammonia removal capacity of European natural zeolite tuffs: Application to aquaculture waste water. Aquaculture and fisheries 25:81-86.

Bower CE, Bidwell JP. 1978. Ionization of ammonia in seawater: effects of temperature, pH and salinity. Journal Fish Research 35: 1012- 1016.

Coeurdacier J, Dutto G. 1999. Effect of chronic exposure to ammonia on alterations of proteins and immunoglobulins in sea bass (Dicentrarchus labrax) serum. Aquat. Living Resour 12(4): 247-253

Colt J. 2006. Water quality requirements for reuse systems. Aquacultural engineering 34: 143-156.

Du Q, Liu S, Cao Z, Wang Y. 2005. Ammonia removal from aqueous solution using natural Chinese clinoptilolite. Separation and Purification Technology 44(3):229-234

Frances J, Nowak BF, Allan GL. 2000. Effects of ammonia on juvenile (Bidyanus bidyanus). Aquaculture 183: 95-103.

FriasEspericueta MG. 1999. Acute toxicity of ammonia to juvenile shrimp penaeus vannamei Boon. Bulletin of Environmental contamination and toxicology.

62:646-652.

Haywood GP. 1983. Ammonia toxicity in teleost fish: a review. Can. Tech. Rep. Fish. Aquat. Science 1177: 1- 35.

Huang H, Xiaoa X, Yana B, Yanga L. 2010. Ammonium removal from aqueous solutions by using natural Chinese (Chende) zeolite as adsorbent. Journal of Hazardous Materials 175(1-3):247-252.

Iwata K, Deguchi M. 1995. Metabolic fate and distribution of N-ammonia in an ammonotelic amphibious fish Periophthalmus modestus following immersion in N- ammonium sulfate: a long term experiment. Zoology Science 12:175-184.

James R, Sampath K, Selvanami P. 2000. Effect of Ion-Exchanging Agent, Zeolite on Removal of Copper in Water and Improvement of Growth in Oreochromis mossambicus. Asian Fisheries Science 13: 317-325.

Boranic M. 2001. The effect of the zeolite clinoptilolite on serum chemistry and hematopoiesis in mice. Food and Chemical Toxicology 39(7):717-727.

Knoph M.B. 1996. Gill ventilation frequency and mortality of Atlantic salmon (salmo salar) exposed to higher ammonia levels in seawater. Water Research oxford

30:837-842.

Lemarie' G, Dosdat A, Coves D, Dutto G, Gasset E, Ruyet JPG. 2004. Effect of chronic ammonia exposure on growth of European seabass (Dicentrarchus labrax) juveniles. Aquaculture 229: 479-491.

Miladinovica N, Weatherleyb LR. 2008. Intensification of ammonia removal in a combined ion-exchange and nitrification column. Chemical Engineering journal

135(1-2):15-24

Mumpto FA, Fishman PH. 1977. The application of natural zeolites in animal science and aquaculture. J.Anim Sciences 45:1188-1203.

Randall DJ, Tsui TKN. 2002. Ammonia toxicity in fish. Marine Pollution Bulletin 45:17-23.

Svobodova Z, Vykusova B. 1995. Diagnostics, prevention and Therapy of fish diseases and intoxication. Publishing of Saabs Royesh, 256 pp.

Swann L. 1993. Transportation of fish in bags. North Central Regional Aquaculture Center Fact. Evolution 104.

Thurston RV, Russo RJ, Luedtke RJ, Smith CE, Meyn EL, Chakoumalos C, Wang KC, Brown D. 1984. Chronic toxicity of ammonia to rainbow trout. Trans. American Fish Society 113: 56-73.

Vijayavel K, Rani EF, Anbuselvan C, Balasubramanian MP. 2006. Interactive effects of monocrotophos and ammonium chloride on the freshwater fish Oreochromis mossambicus with reference to lactate/pyruvate ratio. Biochemistry and Physiology 86: 157-161.

Walsh PJ.  1997. Evolution and regulation of urea synthesis and ureotely in

(Batrachoidid) fishes. Ann. Rev. Physiology 59: 299-323.

Wang Y, Walsh PJ. 2000. High ammonia tolerance in fishes of the family Batrachoididae (Toadfish and Midshipmen). Aquatic Toxicology 50: 205-219

Wilkie MP, Wood CM. 1996. The adaptations of fish to extremely alkaline environments. Comp. Biochemistry & Physiology. 113B, 665-673.

Wood CM. 2001. Toxic responses of the gill. In: Schlenk D, Benson WH. Target Organ Toxicity in Marine and Freshwater Teleosts. Taylor & Francis, London, pp. 1­89.

Genomic Structure of Persian sturgeon Acipenser Persicus larvae Growth Hormone Gene

M. Salamroodi*1. M. Pourkazemi2. M.R. Khoshkholgh1. L. Azizzadeh pormehr2

1 Fisheries Department, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Guilan, Iran, 2 International Sturgeon Research Institute, PO Box 41635-3464 Rasht, Iran.

Introduction

Sturgeon species are among the most ancient fish that still exist on the earth; their presence is confirmed from at least 200 million years ago. Caspian Sea as the largest source of the sturgeon fishes has 6 kinds among 27 species sturgeons in the world. Six sturgeon species, belonging to two genera (Huso and Acipenser), are found in the Caspian Sea and its drainage basin which provide today the bulk of the world's caviar yield (Pourkazemi, 2006). Persian Sturgeon (Acipenser persicus) is a bottom dweller occurring primarily on sand bottoms in the central and southern Caspian Sea, especially along the shores of Iran (Persia). Persian sturgeon has always accounted for the bulk of sturgeon harvest in the Caspian basin and in winter migrates to southern parts of the Caspian Sea

(Ruban. 2011).

Among the genetic factors affecting growth rate, GH gene is naturally considered a main candidate. It is a single chain polypeptide with 2 intra molecular disulfide bonds (Williot et al, 2002). GH has been studied extensively, and the cDNA nucleotide sequences of many teleost GH are available (Saito et al, 1988). However, very little information on this subject has been published with respect to osteichthyes, which include ancient groups of economic value. The aim of this study was to recognition the coding sequence of the Persian GH gene and performs a phylogenetic analysis within the acipenseridae family.

Total RNA was extracted from 4 frozen pituitary glands of Persian sturgeon by using BIOZOL solution for each species. A 3ug quantity of total RNA was reverse transcribed into cDNA. All polymerase chain reaction (PCRs) were performed in 50ul of a solution containing 3mM MgCl2, 0.2nM dNTPs, 1uM of each primers, 1X PCR buffer, Taq DNA polymerase (Cinnagen, Iran). PCR reactions were cycled in the Eppendorf (Germany) by the following program: 5 min at 94°C, then 35 cycles of 30 sec at 94 °C, 30 sec at 58 °C, and 30sec at 72°C. A last step of 25 minutes 72°C was performed in order to optimize the 3 A tailing. Amplified fragment was eluted from agarose gel and directly ligated to InsTA cloning vector (fermentas, France) and cloned in JM107 E.Coli strain highly efficiency competent cell (Fermentas). Recombinant plasmids were sent for sequencing, (Takspouzist co, Iran).

Sequences were aligned using Clustalw X (Thompson et al, 1997) and phylogenetic analysis was performed using MEGA4 (kimura 2 parameter type) for the construction of the distance matrices, NEIGHBOR (Neighbor-Joining) for the generation of 1000 phylogenetic trees. Several growth hormone sequences were obtained from NCBI.

Results and Discussion

This paper describes the molecular cloning, sequence analysis and gene transcription of Persian sturgeon GH cDNA.

The Persian sturgeon GH cDNA contains a 644 nucleotide sequence, respectively (Fig. 1).

GH hormone exhibit typical GH features, such as four cysteine residues, capable of forming two disulfide bonds which are assumed to contribute to the tertiary structure of the hormone molecule, a single tryptophan residue and stretches of amino acid highly conserved in all known GHs. Since the first 24 amino acid residues from the N terminus have a high degree of homology to the signal peptide of other fish GHs, and also with using the Signal P software cleavage site, the signal peptide

was located between amino acid 24 and 25. It is assumed this region probably represent the signal peptide of the pre-GH which is cleaved upon hormone secretion.

Yasuda et al. studied PrGH and found 2 variants of GH, termed GH I and GH II, that had been isolated from the pituitary by alkaline extraction and gel filtration on a Sephadex G-100 column followed by reversed-phase high-performance liquid chromatography (rpHPLC). Both GH consist of 190 aa residues, and contain 2 disulfide bonds at positions 52­163 and 180-188. In our study, we describe the PrGH cDNA sequence for the first time. Only one cDNA was isolated, and it contained 980 bp, with a predicted mature peptide of 190 aa.

1 ATGGCArCAGGTCTGCTrCTGTGTCCAGTGCTGCTGATrAGCTGGACTCCCCTAAGAGTC

MASGLLLC PVLLVI LLVS PK 61 TGGGGCCTACCCTATGATTCCACTATCCAGICITTTCACAAACGCTGTGCTCAGAGCACA

ESGA^YPMIPLSSLFTNAVLR 121 GTACCTACACCAGCTTGCTGCAGACATTTACAAAGATT'TCGAGCGTACCTATGTTCCAGA

AQYLHQLAADIYKDFERTYV 1S TGAGCAACGT CACTCCAGCAAAAACTCCC CGTCAGC AT TC TGCTAC TC TGAGACCATCCC

PDEQRHSSKNSPSAFCYSET 241 TGCTCCCAC T GGCAAAGAT GAGGCCCAACAGC GATC AG AC GT GGAG CTGC T T CAGTTTTC

IPAPTGKDEAQQRSDVELLQ 301 CC TGGC TC T C AT CCAG TCC TGGATTAG TC C C C T GCAGTCC CT GAGCCGTGT T T TCACC AA

Страницы:
1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53 


Похожие статьи

Автор неизвестен - 13 самых важных уроков библии

Автор неизвестен - Беседы на книгу бытие

Автор неизвестен - Беседы на шестоднев

Автор неизвестен - Богословие

Автор неизвестен - Божественность христа