Автор неизвестен - Krmulture in iran - страница 44

Страницы:
1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53 

FSLALIQSWISPLQSLSRVF 361 TAGCCTGGTGTTCAGCACCTCCGACCGAGTGTTTGAGAAACTGAAAGATCTGGAGGAAGG

TNSLVFSTSDRVFEKLKDLE 421 CATTGTGGCTCTCATGAGGGATCTGGGGGAAGGCGGTTTCGGAAGTTCTACTTTGCTGAA

EG IVALMRDLGEGGFGS STL 4 81 GCTCACrTTATGATAAGTrrTGATGTCAACCTAAGAAACGATGATGCTrTTGTTTAAAAATTA

LKLTYDKFDVNLRNDDALFK 54 1 TGGGCT TT T AAGCTGT T TT AAGAAAG AT AT GC ACAAAG TAGAGACG T ACC T GAAAGT GAT

NYGLLSCFKKDMHKVETYLK 601 GAAATGCAGACGTTTTGTGGAGAGCAACTGACCCTCCTGTAGAA 644

VMKCRRFVESNCTL

Fig 1. Complete nucleotide sequence of Persian sturgeon and deduced amino acid sequence. The arrow indicates the possible site for cleavage of signal peptide. The cysteine residues in the mature hormone are asterisked. The potential glycosylation site is underlined.

There is only one Asn-Xaa-Thr motif in both GH amino acids at the C terminus region which is potential site for N- linked glycosylation. The mature form of GH contains 190 residues starting with a Tyrosine for two. The GH gene has been shown to serve as a natural marker because

of its sequence conserved and this work suggests that the GH gene is suitable for phylogenetic analysis.

This result implies that there is only one gene copy for GH. In conclusion, the finding presented that the Persian sturgeon have a highest similarity to the GH sequences of mammalian relative to the other bony fishes, this may be due to the different phylogenetic position of this group.

References

Pourkazemi, M. (2006). Caspian Sea sturgeon Conservation and Fisheries: Past present and Future. Journal of Applied Ichthyology 22 (Suppl. 1), 12-16.

Ruban, G. I., Khodorevskaya, R. P. (2011). Caspian Sea sturgeon fishery: a historic overview. Journal of Applied Ichthyology 27, 199-208.

Yasuda A, Yamaguchi K, Noso T, et al. The complete amino acid sequence of growth hormone from sturgeon (Acipencer guldenstadti). Biochim Biophys Acta 1992,

1120: 297-304.

Saito, A., Sekine, S., Komatsu, Y., Sato, M., Hiranob, T., Itoh, s. (1988). Molecular cloning of eel growth hormone cDNA and its expression in eschericha coli. Gene

73, 545-551.

Williot, p., Arlati, G., Chebanov, M., Gulyas, T., Kasimov, R., Kirschbaum, F., Patriche, N., Pavlovskaya, L.P., Poliakova, L., Pourkazemi, M., Kim, Y., Zhuang, P., Zholdasova, I.M. (2002). Status and Management of Eurasian Sturgeon: An Overview. Internat. Rev. Hydrobiol 87, 483-506.

Molecular cloning and sequence analysis of growth hormone cDNA of Siberian sturgeon larvae, Acipenser baerii

M. Salamroodi*1. M. Pourkazemi2. M.R. Khoshkholgh1, L. Azizzadeh pormehr2

1 Fisheries Department, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, Guilan, Iran,

2 International Sturgeon Research Institute, PO Box 41635-3464 Rasht, Iran. Introduction

Sturgeon is one of the most ancient and valuable groups of fish. The sturgeon usually lives in freshwater, coastal waters and inner seas in North America and Eurasia. Most of the sturgeons in the world are vulnerable to extinction due to overfishing, habitat destruction, water pollution and damming of rivers, which has led to decline of sturgeon populations in their habitats. The Siberian sturgeon (Acipenser baerii) is a species of sturgeon in the Acipenseridae family. It is most present in all of the major Siberian river basins that drain northward into the Kara, Laptev and East Siberian seas.

Among the factors affecting growth rate, growth hormone (GH) is the main candidate and secreted by the anterior pituitary gland. GH is a 22kDa single-chain polypeptide with two disulfide bonds belongs to pituitary hormones together with prolactin and somatolactin (Ganong, 1983). GH plays important roles for promoting somatic growth, development (Riho and Jan, 1999), metabolism in vertebrates and osmoregulation in euryhaline fishes (Sciara et al., 2006). The nucleotide sequence of GH gene has been studied extensively at levels of protein, mRNA and genomic gene in variety of fishes (Chiou et al., 1990) (Marins et al., 2003). In spite of growth hormone has been characterized in many of fish, there are no published data on the structure of Siberian GH gene. The purpose of the present research was to clone and sequence analysis the Siberian sturgeon GH cDNA. Such a study could improve the understanding regarding the GH gene structure in most of the ancient groups.

Material and Methods

Sampling of pituitary glands from Siberian sturgeons were done in Dr Dadman International sturgeon institute (Rasht-Iran) and kept in liquid nitrogen. Total RNA was extracted from frozen pituitary glands by using BIOZOL solution and used for RT-PCR. A 3ug quantity of total RNA was  reverse  transcribed  into  cDNA.   A  forward  PCR primer

(AAAGAATTCATGGCATCAGGTCTGCTTCT) and reverse PCR primer (AAAGGATCCCTACAGAGTACAGTTGCTCT) were designed

to synthesized complete cds of the Siberian sturgeon GH. The upstream PCR primer contained EcoRI restriction site and downstream PCR primer included stop codon immediately after the last codon, followed by BamHI restriction site. PCR was performed in 50ul using 2.5 unite pfu polymerase (Fermentas) and 35 cycles as follows: 5min at 94°C, then 35 cycles of 30 sec at 94 °C, 30sec at 58 °C, 30sec at 72°C and the last cycle of 10 min at 72°C.

The PCR products were electrophoresed through a 1.2 % agarose gel, purification with the Roche PCR purification kit and digested with both EcoRI and BamHI. The digested cDNA was inserted in to PTZ57R that was digested with the same restriction enzyme. Ecoli Top10 was transformed with the ligation product using calcium chloride competent cell. Luria-Bertani (LB) agar plates (1% tryptone, 0.5 % yeast extract, 1% NaCl) containing 50ug/ml ampicillin was used to screen the recombinant colonies. Plasmids from recombinant colonies were prepared by the plasmid extraction kit (Vivantis, Malaysia). Insertion of PCR products were verified by PCR with T7 promotor primer and downstream primer, agarose gel electrophoresis and sequencing. The cDNA sequences have deposited in the GenBank database.

The complete coding sequence of the Siberian sturgeon GH gene contains 642 bp encoding 214 amino acid residues (Fig.1).

ATGGCAICAjGGrCTGCTrCT'31GICCP.GT3';TGCIGGTTAIATTGCT:G'3ICIC:C;CT&Ail i'j MiSGLLLlPVLLVILLVSPK

GASTCTEGSGCClACCCrAT3ATrCCACTA^GCAETCTTriCACAAAC'3CT3T3^TCAa& 120 L     ti     G    A ITMlFliSSiilT'lHAViiH

CCACAGTAC cta-cACCACKT tc ctcca.c acatt tacaaacat ttccaccc tacc patc "t ISO AQTLHJLAS.DZTK.DFERrYV

CCiGaTGaeCAACCTCiirTCiZtGrjL&ajiACTCCCC GTCAPIAT 1CYGCTAfIICTGAGfilTC 240 PDEQ3H33KNSP3AFCYSET

mcrr. TRf!T r.r.c. a htsr:!! a &gb Tr,aRG^n nanr »™» sac etggs am g~tt 7!jvgt "t .1 (1 n : paptssdeacqrdvezjLqf

tccct ggct ctcatcca3tcc t gsattagt ccccigcagtcc ctgagccgt3t tttcacc 360 £   1   a   l   i ashzbplqslsrvft

fiflTJiGCCTGGTG 1TCAG2ACC T C^GACCGAGTGT lTGJiGAAACTGA£A'3AT"TGGAGGi& 420 N     S     Z,    V    T     S rSDHVFEKLKDLEE

ggcat TGTGGCTC TCAT 3AGGGATC TGGGGGAAGGCGGTr1C GGAAGTTC TAC TITGC TG 4BU g    t    v    1     t,    v|    3     d    T,    R    R    g    g    f    g    55    R    t    t. t,

AAGCt UAU1TATGATAAjTT IGAi'G'HJAAU UTAAGAAAUGAT GATGLrrj Gl'T'lAAAAAT 540 KLT    I    D KFDVHLRNDDALFKH

ia.TGGGCT r TTAAGCTGITT r AftE AAAG &XATECACAAAG lAGAGACGIACCTGAAAETG 500 !f    G    L    L    5 3FK.KDMHK.VETYLKV

ATGAAATGCAGAC gtttigt 5GA3 agcaac -atactc tgtag G 4 2 M   k   C   R   R    F    V    E    S    N   Y   T    L '

Fig 1. Complete nucleotide sequence of Siberian sturgeon and deduced amino acid. The arrow indicates the possible site for cleavage of signal peptide. The potential glycosylation sites underlined.

The position of the signal peptide cleavage site was predicted to be at position 111, yielding a signal peptide of 24 amino acids. The first 24 amino acid residues from the N terminus have a high degree of homology to the signal peptide of other fish GHs. It is assumed that in the Siberian sturgeon, this region probably represent the signal peptide of the pre-GH which is cleaved upon hormone secretion. Siberian GH hormone exhibit

typical GH features, such as four cysteine residues, capable of forming two disulfide bonds which are assumed to contribute to the tertiary structure of the hormone molecule, a single tryptophan residue and stretches of amino acid highly conserved in all known GHs. There is only one Asn-Xaa-Thr motif in both GH amino acids at the C terminus region which is potential site for N- linked glycosylation.

Discussion

This paper describes the molecular cloning, sequence analysis of Siberian sturgeon GH cDNA. The GH nucleic acid and amino acid residues of Siberian sturgeon have a highest similarity to GH sequences of mammalian. These results represented that the Siberian sturgeon is primitive fish and are genetically closer to mammalian than to bony fish. The phylogenetic analysis showed that the Siberian sturgeon have a more similarity to GH of other vertebrate than to GH of other fish. Like in other species GH, Siberian sturgeon exhibit typical GH feature, to have 4 cysteine residues, in comparison 5 cysteine residues have been reported in goldfish (Law et al., 1996) and in other Cyprinidae (Chang et al., 1992). These cysteine residues participated in formation of 2 disulfide bonds that have an important role in biological activity of hormone (Vestling et al, 1991). There is a putative glycosylation site in Siberian sturgeon GH. They have been demonstrated that N linked glycosylation site can serve as a signal for protein transport to the cell surface (Guan et al., 1985)

In conclusion, the finding presented that the Siberian GH have a highest similarity to the GH sequences in mammalian than to the other bony fishes, this may be due to the different phylogenetic position of this group.

Chiou, C.-S., Chen, H.-T. and Chang, W.-C.: The complete nucleotide sequence of the growth-hormone gene from the common carp (Cyprinus carpio). Biochim. Biophys. Acta 1087 (1990) 91-94.

Chang YS, Liu CS, Huang FL, Lo TB. (1992) The primary structures of growth

hormones of three cyprinid species, bighead carp, common carp and grass carp. gen comp endocrinol 87, 385-393

Ganong, W.F.: Review of Medical Physiology, 1 lth ed., Lange Medical Publisher, Los Altos, CA 1983, pp. 323-335.

Guan JL, Machamer CE, Rose JK. (1985) Glycosylatiion allows cell surface transport of an anchord secretary protein, Cell 42, 489-496

Law MS, Cheng KW, Fung TK, Chan YH, Yu KL, Chan KM. (1996) Isolation and characterization of two distinct growth hormone cDNAs from gold fish Carassius auratus. Arch Biochem Biophys 330, 10-23

Marins LF, Jose AL, Josep MF and Armand S (2003) A growth hormone-based

phylogenetic analysis of euteleostean fishes including a representative species of the Atheriniformes Order, Odontesthes argentinensis. Genet Mol Biol 26:295­300.

Riho, G., and Jan, N. (1999). Restriction fragment length polymorphism at the growth hormone 1gene in Atlantic salmon (Salmo salar L.) and its association with weight among the offspring of a hatchery stock. Aquaculture 173(1-4):73-80.

Sciara AA, Rubiolo JA, Somoza GM and Arranz SE (2006). Molecular cloning, expression and immunological characterization of pejerrey (Odontesthes bonariensis) growth hormone. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 142: 284-292.

Vestling M, Murphy C, Fenselau C, Chen TT.(1991) Disulfide bonds in native and recombinant fish growth hormone. Mol Mar Biol Biotechnology 1, 73-77

Homeopathic remedies as an alternative medicine for aquatics and all other creatures diseases

Maryam Salehi

Iranian Fisheries Research Organisation m salehi743@yahoo.com

Objectives

Homeopathy or " Similar Therapy " is a phylum of " Alternative Medicines " that belong to 7000 years ago. Dr. Bograt ( 2500 years before the Jesses Birthday ), had used homeopathic remedies to cure his patients.

Dr. Samuel Hahnemann ( 1755-1843 ) who was a German physician and chemist, proved homeopathic remedies on himself and stabilized the symptoms occurred during different diseases. His philosophical and principal book is " Organon of Medicines " which means " rules of homeopathy

In 1982, the British Association of Homeopathic Veterinary Surgeons

( BAHVS ) was formed.

In 1984, Veterinary Courses commenced at the Royal Lond Homeopathic Hospital were formed.

In April 1989, the International Association for Veterinary Homeopathy ( IAVH ) was founded in Luxembourg.

Nowadays , homeopathy is accepted as a safe therapy in the world. Homeopathic remedies are natural, without any side effects for curing acute and chronic diseases of humans, animals and herbs.

Materials &Methods:

Homeopathic remedies are in different potencies ( dozes ). At first, all remedies are prepared as " Mother Tincture " or Q form. There are 1/10 dilution = Decimal (1x ) means, one ml of mother tincture doze  of remedy  in  9 ml  of distilled  water ,    V100 dilution =

Centicimal (1C ), one ml of mother tincture of remedy in 99 ml of distilled water and   V1000 dilution = Milecimal ( 1M).

We have 2X, 3X, 4X, 6X, 12X ( 1/1012 ) dilution , 30X , 50X .

3C, 6C ( V1006 ) dilution , 12C, 30C, 200C .

1M, 10M ( 1/100010 ) dilution , 50M, 100M, LM ,

Usually ,high potencies 200C and 1M - LM , are using to cure chronic diseases like mental diseases ( Migraine, Hysteria , MS, Aids, Depressions,... ), in one or two time weekly, in one or two time monthly, up to 48 days and chronic diseases may be cured after one week up to 6 months.

Low potencies 3X, 6X and 12X are using to cure acute diseases (Coldness, injuries , damages, influenza,.), in short intervals (each 3 or 6 o'clock) , 3 glob every day,... and the acute diseases may be cured after one doze or after one or two days. 30C is a moderate potency that some Homeopaths use this potency to cure the patients .

According to Dr. Hahnemann's rule in his book " Organon of Medicines ", the best prescription of homeopathic remedies is an individually constitutional remedy, Specially to cure chronic diseases . But in pathological and acute cases, such as crashes, damages, coldness,. we can use the remedies with high dozes and we can use two or more mixed remedies to cure these acute diseases.

Sometimes, there is " Aggravations " after consuming homeopathic remedies. This is a good sign of curing, because after 24 - 48 hours of aggravation, any symptoms of disease could be cured

( Salehi,2010 ).

In homeopathy , we have a type of remedy "Nosodes", it is made from the pus or any secretion of the infectious organ of patient . This remedy are useful to cure infections, whereas, each infection disease, could be cured by its nosodes .

At the " Alternative Veterinary Medicine Centre" ( A VMC ), they make "nosodes" for infectious diseases, like bacterial and fungal diseases. Such methods have proved beneficial in former cases. They

cooperate closely with the veterinary surgeon, who has responsibility for the fish diseases.

Results & Conclusions:

Dr. Rob Robertson, M.D & Dr. Will Falconer, DVM,2010, worked on the immune system of animals by homeopathic remedies .

Dr. Jeffrey Levy, DVM ; Alfred Plechner, DVM & Dee Blanco, DVM,2010, are working on the allergies of cats and dogs.

Species treated by the AVMC include: horses, ponies, goats, donkeys, mules, cats, dogs, pigs, sheep, llamas, alpacas, rabbits, ferrets, guinea pigs, lizards, terrapins, tortoises, snake, raptors, poultry ( domestic fowl ), cage birds, budgies, canaries, budgerigars, parrots, macaws, birds of prey ( raptors )

Dr. S. Abutbul, A.Golan-Goldhirsh, O.Barazani and D.Zlberg, 2004 in their article " Use of Rosmarinus officinalis as a treatment against Streptococcus iniae in tilapia " showed that all 6 extracts of R. oficinalisf were effective in inhibiting bacterial growth

Fish can suffer stress from temperature changes, transportation, injury, fighting, handling or water changes. Homeopathic remedies : Aconitum, Aurum, Lycopodium, Argentum nitricum, Gelsemium or Lachesis may prove useful, depending upon the stress stimulus.

Dr. Girish Gupta & Dr. A.K. Srivastava,2002, at the result of their

project " In-vitro activity of Thuja occidentalis Linn. against human pathogenic aspergilli ", showed that between different potencies of Thuja occidentalis Q, 30C, 200C, 1M, 50M, Thuja 30C & 200C are found to inhibit the linear diametric growt of Aspergillus flavus equally on 9th day of post incubation. Thuja 50M was very effective against Aspergillus niger .

In "IFRO", I have a project " The comparative study of the effects of streptococcinum, Hepar sulfur, Rosmarinus officinalis and erythromycin in cultured rainbow trout ( Oncorhynchus mykiss ) with experimental streptococcusis" that is not over.

Strategies   for prophylaxis   and   control   of   WSSV include

Iran-Larvi, ll-!2 December 2Ol2-Karaj

improvement of environmental conditions, stocking of specific pathogen free ( SPF) shrimp post-larvae and enhancement of disease resistance by using immune-stimulants. Immuno stimulants are herbal substances, which enhance the non-specific defense mechanism and provide resistance against pathogenic organism ( Citrasu et al., 2006 ).

Homeopathic remedies such as S.triblobatum, A. paniculata and P. corylifolia were found to reduce vibrio in P. monodon three time when supplied in enriched Artemia ( Citrasu et al.,2002,2009 ).

Babu ( 1999 ) demonstrated significant increase in fecundity , gonadal weight and reduced intermoult period in P. monodon when the shrimp fed maturation diet containing W. somnifera, Mucuna pruita, Ferula asafetida and Piper longum extracs.

Keywords: Streptococcusis, R.off, , remedy, Hahnemann, Homeopathy

Tuja occidentalis

Aurum

Alernative Veterinary Medicine Centre,2010/04/07;

http://alternativevet.org/homeopathy.htm

Alternative Veterinary Medicie Centre, 2010/06/29; Fish Diseases ;

http://www.alternativevet.org/fish_diseases.htm

Dr. Dimpi Shah, 2009, Homeopathic    Remedies    at    a Glance,

SIMILIMA.COM

Dr. Girish Gupta; Dr. A.K. Srivastava, In-vitro activity of Thuja occidentalis against human pathogenic aspergeilli, The Homeopathic Heritage , Vol.27, No. 1, Jan 2002, pg. 5-12

Dr.John Henry Clarke, 2000; Dictionary of Practical Materia Medica, Vol: 1,2,3 ; Indian Books & Periodicals Publishers ; B-5/62, Dev Nagar, Pyare Lal Road , Karol Bagh New Delhi-110 005.

Herbal medicine in aquaculture, INTERNATIONAL AQUAFEED,

March-April 2010-2011.

Effect of dietary protein on growth, feed conversion, and survival of Eurasian perch larva (Perca fluviatilis)

Behnam Salimi1*, Afshin Esmaeili 2

1* Department of Aquatic animal Health and Disease, Sanandaj Branch, Islamic Azad

University, Sanandaj,Iran. E-mail: Beh.salimi@yahoo.com 2 Department of Aquatic animal Health and Disease, Science and Research Branch,

Islamic Azad University, Tehran, Iran.

Abstract

Triplicate groups of Eurasian perch (Perca fluviatilis) larva were fed five experimental diets containing protein levels varying from 246 to 635 g kg-1 dry matter (d.m.) for 45 days. Dietary protein was supplied by graded amounts of fish meal (with 690 g kg-1 crude protein). Crude lipid and gross energy content of 100-107 g kg-1 and 18.8-20.5 MJ kg-1 remained constant between experimental diets. Eurasian perch with an initial body weight of 1.02 ± 0.05 g were randomly distributed in 15 tanks of similar recirculation systems and fed on gradually decreasing feeding rates of 10 to 6% of their body weight per day. Growth performance and feed conversion increased with dietary protein level from 246 to 550 g kg-1 d.m. but did not decline at highest dietary protein level. Protein efficiency ratio declined linearly with increasing dietary protein. Survival ranged between 86.9 and 91.1% and was not affected by dietary composition. The dietary protein requirement for Eurasian perch larva calculated by broken-line and second-order polynomial regression ranged between 489 and 530 g kg-1 , respectively.

Key words: feed efficiency, growth, Eurasian perch, protein requirement, survival.

Fish feed constitutes one of the largest costs in aquaculture; therefore inefficient feed management will have a negative impact on fish farm economics. Eurasian perch (Perca fluviatilis, Linnaeus, 1758) is a relatively new candidate for freshwater aquaculture, however little is known about the nutrient requirements of this species. Eurasian perch show high growth rates and are high valued due to its excellent flesh quality. The aim of this study was to Effect of dietary protein on growth, feed conversion, and survival of Eurasian perch larva. Previous investigations (Kestemont et al. 1996; Melard et al 1996; Ljunggren et al. 2003; Stejska et al. 2009; Mandiki et al 2011; Strand et al. 2011) have shown that Eurasian perch can be reared in recirculation system and fed artificial diets very efficiently, but knowledge of the nutritional requirements of Eurasian perch is limited. It is well known that formulation of balanced diets and their adequate feeding are important for successful aquaculture. Protein is one of the major dietary nutrients effecting growth performance of fish (Lovell 1979). Dietary protein provides essential and non-essential amino acids to synthesize body protein and energy for maintenance. According to fish species, fish size, dietary protein sources and environmental conditions protein requirements ranges from 300 to 550 g kg-1 (NRC 1993).

Materials and methods

Experimental design

According to Zienert & Wedekind (2001), the phase of weaning Eurasian perch to formulated diets is lasted 18 days. Afterwards A total of 900 Eurasian perch larva with an initial body weight of 1.02 ± 0.05 g were randomly distributed in 15 tanks with a volume of 230 L of recirculation systems. each recirculation system comprised of five tanks and a filtration unit with a sedimentation chamber for settlement of particulate matter and a trickling filter filled with plastic tubes for biological purification. Mean and standard deviation (±) of water temperature,   pH,   O2-content   and   conductivity   (measured with

multimeter) during the experiment in all tank were similar: 22.9°C (±1.1), 8.0 (±0.1), 6.9 mg -1 (±0.3) and 778.4 usm cm-1 (±2.2) .Five experimental diets with varying protein contents were prepared. Dry ingredients were mixed and then blended with lipid and water using a kitchen blender. Pelleting of each diet was carried out by passing the blended mixture through a laboratory pellet machine with 1-mm diameter holes. The wet pellets were dried at 30 °C for 2 days using an electric fan. The proximate analysis of experimental diets showed that the protein content ranged 246,359,480,551 and 635 g kg-1 while the crude lipid (101-107 g kg-1) and gross energy (GE, 19.9-20.6 MJ kg-1) content remained constant between the diets. Fifteen tanks of the similar recirculation systems were stocked with 50 fish each and a natural light/dark cycle was adopted. The adjacent feeding experiment was conducted over a period of 45 days. The five diets were randomly allotted in triplicate. Fish were fed manually in 4 rations per day and the tanks were cleaned from settled faces and uneaten feed once a day. Each group was weighed every 2 weeks to adjust daily feed supply of an average of 7.5% of total biomass.

Results

Fish fed diet containing 246 g kg-1 d.m. crude protein showed significantly lowest and those fed 551 g kg-1 d.m. crude protein showed highest WG of 2.89 and 4.21 g, respectively. Resulting SGR of 3.09% day-1 of fish fed diet P 551 was significantly higher compared with P 246

(2.42% day-1) and P 359 (2.75% day-1) fed fish. Although mean WG and

SGR of fish fed P 635 diet decreased compared with fish fed P 551 no significant differences could be observed. Feed conversation ratio decreased in general with increasing dietary protein level (from 246 to 551 g kg-1 d.m.) from 2.47 to 1.86. Fish fed diet P 635 obtained higher FCR of 1.95, but without significant differences compared with fish fed diet P 359, P 480 and P 551. Protein conversion expressed as PER decreased linearly with increasing dietary protein supply. Thus, significant highest PER of 1.73 could be observed in fish fed diet P 246 and lowest PER were calculated for fish fed diet P 635 (0.92). Survival

and condition factor were not affected by the dietary protein content and ranged between 86.9% (P 246) - 91.1% (P 551).

Based on the SGR response using broken-line model, optimum dietary protein level for growth of Eurasian perch larva was estimated to be 489 g kg-1 d.m. at GE level ranging between 19.9 and 20.6 MJ kg-1. Dietary protein requirement calculation by second-order polynomial regression amounted 530 g kg-1.

Discussion

In general there exist only a few scientific reports on the nutritional requirements of percids (Brown & Barrows 2002). Compared with the growth parameter (SGR: 2.42-3.09% day-1; FCR: 1.86- 2.47) obtained in this study, Nyina-Wamwiza et al. (2005) observed relatively low SGR of 0.56-1.00% day-1, but comparable or better feed conversion of 0.97-1.78 (calculated from the presented feed efficiency). In comparison with values reported for other percids, obtained SGR were in the range or even higher (Brown et al. 1996; Hilge & Steffens 1996; Kestemont & Melard

2000; Mandiki et al. 2004; Schulz et al. 2006). High FCR seemed to be

related with territorial behaviour of dominant individuals, which were able to defend feeding point and feed resources as it is described for Eurasian perch (Perca fluviatilis) (Melard et al. 1996). Therefore, high daily feeding ratio (6-10% day-1) was chosen to ensure dietary feed intake of the whole fish stock. But this feeding regime yielded in excessive amounts of uneaten feed and probably overestimated FCR values based on the feed supply. In this study increasing dietary protein contents from 246 to 551 g kg-1 resulted in a marked improvement of SGR and FCR. It is well known that fish reach a plateau or decreased WG, if they were fed diets containing protein levels above the requirements (NRC 1993). Based on the relationship described by broken-line or second-order polynomial regression analyses between dietary protein content and SGR, requirement of Eurasian perch larva for dietary protein ranged between 489 and 530 g kg-1.

1- Brown, P.B., Dabrowski, K. & Garling, D.L. (1996) Nutrition and feeding of yellow

perch (Perca fflavescens). J. Appl. Ichthyol., 12, 171-174.

2- Brown, P.B. & Barrows, F.T. (2002) Percids. In: Nutrient Requirements and Feeding

of Finfish for Aquaculture (Webster, C.D. & Lim, C.E. eds), pp. 219-229. CABI Publishing, New York.

3- Hilge, V. & Steffens, W. (1996) Aquaculture of fry and fingerling of pike-perch

(Stizostedion lucioperca L.) a short review. J. Appl. Ichthyol., 12, 167-170.

4- Kestemont, P., M6lard, C., Fiogbe, E., Vlavonou, R. and Masson, G. (1996),

Nutritional and animal husbandry aspects of rearing early life stages of Eurasian perch Perca fluviatilis. Journal of Applied Ichthyology, 12: 157-165.

5- Kestemont, P. & Melard, C. (2000) Aquaculture. In: Percid Fishes Systematics,

Ecology and Exploitation, Chapter 11 (Craig, J.F ed.), pp. 191-224. Blackwell Science, Oxford, UK.

6- Ljunggren, L., Staffan, F., Falk, S., Lind6n, B. andMendes, J. (2003), Weaning of

juvenile pikeperch,Stizostedion lucioperca L., and perch, Perca fluviatilis L., to formulated feed. Aquaculture Research,34: 281-287.

7- Lovell, R.T (1979) Factors affecting voluntary feed consumption by channel catfish.

In: Proceedings of Annual Conference of Southeast Association of Fish and

Wildlife Agencies, 33, 563-571.

8- Mandiki, S.N.M., Blanchard, G., Melard, C., Koskela, J., Kucharczyk, D., Fontaine,

P. & Kestemont, P. (2004). Effects of geographic origin on growth and food intake in Eurasian perch (Perca fluviatilis L.) juveniles under intensive culture conditions. Aquaculture, 229, 117-128.

9- Mandiki, S., Milla, S., Wang, N., Blanchard, G., Djonkack, T., Tanascaux, S. and

Kestemont, P. (2011),Effects of probiotic bacteria on growth parameters and immune defence in Eurasian perch Perca fluviatilis L. larvae under intensive culture conditions. Aquaculture Research, 42: 693-703.

Страницы:
1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53 


Похожие статьи

Автор неизвестен - 13 самых важных уроков библии

Автор неизвестен - Беседы на книгу бытие

Автор неизвестен - Беседы на шестоднев

Автор неизвестен - Богословие

Автор неизвестен - Божественность христа